Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 6006631
End position: 6006654
Length: 24

DNA sequence
>NC_022657, from 6006631 to 6006654 (24 bp); Actinoplanes friuliensis DSM 7358 ACGGCGACCGCGACGGTGCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6005395-6007569	Sequence	AFR_27645 - MmpL domain-containing protein (Protein is coded in complementary strand; from 6007569 to 6005395)