Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 5956534
End position: 5956557
Length: 24

DNA sequence
>NC_022657, from 5956534 to 5956557 (24 bp); Actinoplanes friuliensis DSM 7358 CGGGCGCCGGCGCCGGCGCGGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5956023-5956715	Sequence	AFR_27430 - hypothetical protein (Protein is coded in complementary strand; from 5956715 to 5956023)