Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 5919913
End position: 5919945
Length: 33

DNA sequence
>NC_022657, from 5919913 to 5919945 (33 bp); Actinoplanes friuliensis DSM 7358 GCAGTTCGGGTGCGGTCCGGGTGCAGTTCAGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 5919941-5920789	Sequence	AFR_27295 - chemotaxis protein CheR (Protein is coded in complementary strand; from 5920789 to 5919941)