Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 5835751
End position: 5835804
Length: 54

DNA sequence
>NC_022657, from 5835751 to 5835804 (54 bp); Actinoplanes friuliensis DSM 7358 CTGCTGTCCGGGCTGCTGCTGCCGTCCGGGCCGTTGCCGCTGTCCGGGCCGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5834890-5836659	Sequence	AFR_26925 - magnesium chelatase subunit ChlD (Protein is coded in complementary strand; from 5836659 to 5834890)