Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 5813073
End position: 5813135
Length: 63

DNA sequence
>NC_022657, from 5813073 to 5813135 (63 bp); Actinoplanes friuliensis DSM 7358 AACGAGGAGCTGGAGACCACGAACGAGGAACTCCAGTCCACGGTCGAGGAGTTGGAGACCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5811778-5813625	Sequence	AFR_26795 - putative MCP methyltransferase CheR with PAS domain