Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 5763400
End position: 5763426
Length: 27

DNA sequence
>NC_022657, from 5763400 to 5763426 (27 bp); Actinoplanes friuliensis DSM 7358 GCCGACGTCGCCGACTTCGCCGACGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5763065-5763715	Sequence	AFR_26560 - LuxR family two component transcriptional regulator