Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 5723484
End position: 5723519
Length: 36

DNA sequence
>NC_022657, from 5723484 to 5723519 (36 bp); Actinoplanes friuliensis DSM 7358 ACGATGAAGCCGACGATCAGGCCGGCGATGATGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5722689-5723636	Sequence	AFR_26340 - putative sec-independent protein translocase TatC (Protein is coded in complementary strand; from 5723636 to 5722689)