Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 5699568
End position: 5699600
Length: 33

DNA sequence
>NC_022657, from 5699568 to 5699600 (33 bp); Actinoplanes friuliensis DSM 7358 CTGCGCCCGGCCGGCGCCCTGCCGGCACCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5699401-5700363	Sequence	AFR_26225 - Membrane-bound lytic murein transglycosylase F