Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 5653217
End position: 5653276
Length: 60

DNA sequence
>NC_022657, from 5653217 to 5653276 (60 bp); Actinoplanes friuliensis DSM 7358 GGTGGGCGGCGGGGTCGTCGGCGGCGGGGTCGTGGCCGGCGGCGTGGACGGCGGCGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5652906-5654219	Sequence	AFR_26010 - cellobiohydrolase A (1 4-beta-cellobiosidase A)-like protein (Protein is coded in complementary strand; from 5654219 to 5652906)