Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 5652475
End position: 5652519
Length: 45

DNA sequence
>NC_022657, from 5652475 to 5652519 (45 bp); Actinoplanes friuliensis DSM 7358 ACAGAAGTCGGCGGGACCGACGTTGGCGGGACCGAGGTCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5651773-5652912	Sequence	AFR_26005 - Endoglucanase E-4 (Protein is coded in complementary strand; from 5652912 to 5651773)