Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 5532500
End position: 5532523
Length: 24

DNA sequence
>NC_022657, from 5532500 to 5532523 (24 bp); Actinoplanes friuliensis DSM 7358 CGTTGTCGTAGTCCTTGTCGTTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5532391-5533521	Sequence	AFR_25535 - putative ABC transporter substrate-binding protein (Protein is coded in complementary strand; from 5533521 to 5532391)