Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 5503904
End position: 5503933
Length: 30

DNA sequence
>NC_022657, from 5503904 to 5503933 (30 bp); Actinoplanes friuliensis DSM 7358 CTCGCCGGGCAGCGCCGGGCCTGGCCAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5503716-5504573	Sequence	AFR_25395 - hypothetical protein (Protein is coded in complementary strand; from 5504573 to 5503716)