Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 547400
End position: 547462
Length: 63

DNA sequence
>NC_022657, from 547400 to 547462 (63 bp); Actinoplanes friuliensis DSM 7358 CAAGCCTGGACCTGAACCGGGAACGCCCGGACCTGAACCGGGAACGCCCGGGCCTGAACCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 547220-547675	Sequence	AFR_02495 - hypothetical protein (Protein is coded in complementary strand; from 547675 to 547220)