Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 5273137
End position: 5273169
Length: 33

DNA sequence
>NC_022657, from 5273137 to 5273169 (33 bp); Actinoplanes friuliensis DSM 7358 GCGGCGGCGGGGCGGCGGCTGGGCGGCTTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5271461-5273206	Sequence	AFR_24390 - binding-protein-dependent transport systems inner membrane component (Protein is coded in complementary strand; from 5273206 to 5271461)