Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 5217872
End position: 5217931
Length: 60

DNA sequence
>NC_022657, from 5217872 to 5217931 (60 bp); Actinoplanes friuliensis DSM 7358 CCGGACCTGACCCGGCCGGACCTGACCCGGCCGGACCTGACCCGGCCGGACCTGACCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5216887-5218932	Sequence	AFR_24120 - L-lactate permease (Protein is coded in complementary strand; from 5218932 to 5216887)