Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 5132852
End position: 5132876
Length: 25

DNA sequence
>NC_022657, from 5132852 to 5132876 (25 bp); Actinoplanes friuliensis DSM 7358 CCGGGCCAGGCCGGGCCCGGCCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5129565-5133989	Sequence	AFR_23680 - non-ribosomal peptide synthetase-like protein (Protein is coded in complementary strand; from 5133989 to 5129565)