Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 5116148
End position: 5116171
Length: 24

DNA sequence
>NC_022657, from 5116148 to 5116171 (24 bp); Actinoplanes friuliensis DSM 7358 GTGACCGTGCCCGCGACCGCGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5108450-5119195	Sequence	AFR_23670 - non-ribosomal peptide synthetase-like protein (Protein is coded in complementary strand; from 5119195 to 5108450)