Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 5060648
End position: 5060683
Length: 36

DNA sequence
>NC_022657, from 5060648 to 5060683 (36 bp); Actinoplanes friuliensis DSM 7358 CGCCGCCCGCAGCGCAGCCAGCAGCGCCGCCAGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5060523-5061326	Sequence	AFR_23410 - methylisocitrate lyase (Protein is coded in complementary strand; from 5061326 to 5060523)