Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 4933753
End position: 4933776
Length: 24

DNA sequence
>NC_022657, from 4933753 to 4933776 (24 bp); Actinoplanes friuliensis DSM 7358 CGTCGTCGACGTAGTCGTCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4933677-4934483	Sequence	AFR_22790 - putative molybdopterin oxidoreductase (Protein is coded in complementary strand; from 4934483 to 4933677)