Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 4755737
End position: 4755781
Length: 45

DNA sequence
>NC_022657, from 4755737 to 4755781 (45 bp); Actinoplanes friuliensis DSM 7358 AGGCGCCGGGGTCGTGGGCGCGGGCGTCGTGGGAACCGGGGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4754790-4756490	Sequence	AFR_21905 - hypothetical protein (Protein is coded in complementary strand; from 4756490 to 4754790)