Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 4737223
End position: 4737246
Length: 24

DNA sequence
>NC_022657, from 4737223 to 4737246 (24 bp); Actinoplanes friuliensis DSM 7358 GCACCGCCACCGTCACCGGCTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4736763-4737821	Sequence	AFR_21820 - L-erythro-3,5-diaminohexanoate dehydrogenase (Protein is coded in complementary strand; from 4737821 to 4736763)