Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 4727752
End position: 4727796
Length: 45

DNA sequence
>NC_022657, from 4727752 to 4727796 (45 bp); Actinoplanes friuliensis DSM 7358 GGACGATCTCGCCCTCGACGACCTCACCCTGGACGATCTCCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4727748-4728278	Sequence	AFR_21780 - hypothetical protein (Protein is coded in complementary strand; from 4728278 to 4727748)