Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 466150
End position: 466176
Length: 27

DNA sequence
>NC_022657, from 466150 to 466176 (27 bp); Actinoplanes friuliensis DSM 7358 CGCCGAACTCACCGAACTCGGCGAACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 465345-466466	Sequence	AFR_02195 - phosphoserine aminotransferase (Protein is coded in complementary strand; from 466466 to 465345)