Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 464453
End position: 464476
Length: 24

DNA sequence
>NC_022657, from 464453 to 464476 (24 bp); Actinoplanes friuliensis DSM 7358 GTCCTCGTACTCGTCGTCGTGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 464025-465206	Sequence	AFR_02190 - putative aminotransferase (Protein is coded in complementary strand; from 465206 to 464025)