Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 4555101
End position: 4555148
Length: 48

DNA sequence
>NC_022657, from 4555101 to 4555148 (48 bp); Actinoplanes friuliensis DSM 7358 TCGGCGGGCGGTTCGGCGGGCGGTTCGGCGGGCGGTTCGGCGGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4554591-4555541	Sequence	AFR_20910 - histidine kinase (Protein is coded in complementary strand; from 4555541 to 4554591)