Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 4548831
End position: 4548860
Length: 30

DNA sequence
>NC_022657, from 4548831 to 4548860 (30 bp); Actinoplanes friuliensis DSM 7358 CGAGGACGAGGACGAGGACGAGGACGAGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4548337-4549023	Sequence	AFR_20875 - putative sortase family protein (Protein is coded in complementary strand; from 4549023 to 4548337)