Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 4482325
End position: 4482378
Length: 54

DNA sequence
>NC_022657, from 4482325 to 4482378 (54 bp); Actinoplanes friuliensis DSM 7358 GACGCCCGCGCCTGCCCGGACCACGGCGCCTGCCCGGACCAGCGCGCCTGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4481892-4483040	Sequence	AFR_20560 - putative macrolide-specific efflux protein macA