Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 4231060
End position: 4231084
Length: 25

DNA sequence
>NC_022657, from 4231060 to 4231084 (25 bp); Actinoplanes friuliensis DSM 7358 CGGGCCCGGCCGGACCAGGCCGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4228865-4231627	Sequence	AFR_19350 - alpha-L-rhamnosidase (Protein is coded in complementary strand; from 4231627 to 4228865)