Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 4170747
End position: 4170770
Length: 24

DNA sequence
>NC_022657, from 4170747 to 4170770 (24 bp); Actinoplanes friuliensis DSM 7358 CGCCGCCGCTGCCACCGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4169836-4170807	Sequence	AFR_19040 - xanthine dehydrogenase (Protein is coded in complementary strand; from 4170807 to 4169836)