Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 4133646
End position: 4133672
Length: 27

DNA sequence
>NC_022657, from 4133646 to 4133672 (27 bp); Actinoplanes friuliensis DSM 7358 CGACCGCGCCGATCGCGCCGACCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4132712-4134058	Sequence	AFR_18885 - alkaline phosphatase (Protein is coded in complementary strand; from 4134058 to 4132712)