Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 4118529
End position: 4118564
Length: 36

DNA sequence
>NC_022657, from 4118529 to 4118564 (36 bp); Actinoplanes friuliensis DSM 7358 TCCGCGAGGCCGTCCGCGAAGCCGTCCCCGAGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4118361-4118738	Sequence	AFR_18820 - hypothetical protein (Protein is coded in complementary strand; from 4118738 to 4118361)