Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 3867849
End position: 3867893
Length: 45

DNA sequence
>NC_022657, from 3867849 to 3867893 (45 bp); Actinoplanes friuliensis DSM 7358 GTGACCGGCGGGGTGGTGACCGGCGGTGTGGTGACCGGCGGTGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3867534-3868649	Sequence	AFR_17880 - putative cellulose/chitin-binding protein (Protein is coded in complementary strand; from 3868649 to 3867534)