Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 3834193
End position: 3834232
Length: 40

DNA sequence
>NC_022657, from 3834193 to 3834232 (40 bp); Actinoplanes friuliensis DSM 7358 CTCAGTCCGCCTCAGTCCGCCTCAGTCCGCCTCAGTCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3834225-3835850	Sequence	AFR_17720 - putative amidohydrolase (Protein is coded in complementary strand; from 3835850 to 3834225)