Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 3786153
End position: 3786176
Length: 24

DNA sequence
>NC_022657, from 3786153 to 3786176 (24 bp); Actinoplanes friuliensis DSM 7358 GGCGGTGGGGGTGGGGGTGGGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3785872-3787203	Sequence	AFR_17530 - putative serine/threonine protein kinase (Protein is coded in complementary strand; from 3787203 to 3785872)