Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 3727631
End position: 3727655
Length: 25

DNA sequence
>NC_022657, from 3727631 to 3727655 (25 bp); Actinoplanes friuliensis DSM 7358 CGGCCCGGTCCAGCCCGGTCCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3727351-3728289	Sequence	AFR_17245 - anti-sigma regulatory factor (Ser/Thr protein kinase) (Protein is coded in complementary strand; from 3728289 to 3727351)