Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 3668174
End position: 3668197
Length: 24

DNA sequence
>NC_022657, from 3668174 to 3668197 (24 bp); Actinoplanes friuliensis DSM 7358 ACGTCGACGTCACCGTCGACGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3665945-3670291	Sequence	AFR_16965 - peptidase S8 and S53 subtilisin kexin sedolisin