Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 3620445
End position: 3620468
Length: 24

DNA sequence
>NC_022657, from 3620445 to 3620468 (24 bp); Actinoplanes friuliensis DSM 7358 GGCGAGGGCGCGGGCGATGGCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3620254-3620925	Sequence	AFR_16730 - putative ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 3620925 to 3620254)