Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 3597165
End position: 3597188
Length: 24

DNA sequence
>NC_022657, from 3597165 to 3597188 (24 bp); Actinoplanes friuliensis DSM 7358 TCGACGTCCACGTCGACGACGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3596445-3597254	Sequence	AFR_16645 - cobalamin/Fe3+-siderophore ABC transporter ATPase