Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 3444495
End position: 3444524
Length: 30

DNA sequence
>NC_022657, from 3444495 to 3444524 (30 bp); Actinoplanes friuliensis DSM 7358 GCGCCCGGCAGCGGCCGGAAGCGCTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3444096-3445661	Sequence	AFR_15945 - acetyl-coenzyme A synthetase (Protein is coded in complementary strand; from 3445661 to 3444096)