Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 3206912
End position: 3206947
Length: 36

DNA sequence
>NC_022657, from 3206912 to 3206947 (36 bp); Actinoplanes friuliensis DSM 7358 GGTGTCGAAGGAGGCGTGGAAGGAGGTGTCGACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3206582-3207841	Sequence	AFR_14895 - cellulose-binding family ii (Protein is coded in complementary strand; from 3207841 to 3206582)