Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 309769
End position: 309831
Length: 63

DNA sequence
>NC_022657, from 309769 to 309831 (63 bp); Actinoplanes friuliensis DSM 7358 CGTCGGCTTCGTCGTCGGCGTCGTCGGCTTGGTGGTCGGGGTTGTCGGCTTGGTGGTCGGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 309557-311203	Sequence	AFR_01465 - hypothetical protein (Protein is coded in complementary strand; from 311203 to 309557)