Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 3071023
End position: 3071052
Length: 30

DNA sequence
>NC_022657, from 3071023 to 3071052 (30 bp); Actinoplanes friuliensis DSM 7358 GTTGAGTGCTCGTGAGTGCTTTTGAGCGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3071053-3072408	Sequence	AFR_14245 - hypothetical protein (Protein is coded in complementary strand; from 3072408 to 3071053)