Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 2945486
End position: 2945512
Length: 27

DNA sequence
>NC_022657, from 2945486 to 2945512 (27 bp); Actinoplanes friuliensis DSM 7358 GGTGGGTGAGATGGGTGAGGTGGGTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2945466-2946356	Sequence	AFR_13635 - helix-turn-helix domain-containing protein (Protein is coded in complementary strand; from 2946356 to 2945466)