Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 2384809
End position: 2384835
Length: 27

DNA sequence
>NC_022657, from 2384809 to 2384835 (27 bp); Actinoplanes friuliensis DSM 7358 GCCGAGCAGGGCGAGCAGGCCGAGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2383742-2384938	Sequence	AFR_11035 - putative two-component system sensor kinase (Protein is coded in complementary strand; from 2384938 to 2383742)