Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 2120467
End position: 2120493
Length: 27

DNA sequence
>NC_022657, from 2120467 to 2120493 (27 bp); Actinoplanes friuliensis DSM 7358 GCCAGCCAGGCCGGCCAGGCCATCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2120044-2120811	Sequence	AFR_09835 - hypothetical protein (Protein is coded in complementary strand; from 2120811 to 2120044)