Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 2010823
End position: 2010846
Length: 24

DNA sequence
>NC_022657, from 2010823 to 2010846 (24 bp); Actinoplanes friuliensis DSM 7358 CGGCGTCGGCGGCCGCGTCGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2010183-2012039	Sequence	AFR_09285 - putative cobalamin biosynthesis protein (Protein is coded in complementary strand; from 2012039 to 2010183)