Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 2007687
End position: 2007710
Length: 24

DNA sequence
>NC_022657, from 2007687 to 2007710 (24 bp); Actinoplanes friuliensis DSM 7358 GGCGGCGGCGTCCGCGGCGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2006677-2008227	Sequence	AFR_09270 - leucyl aminopeptidase (Protein is coded in complementary strand; from 2008227 to 2006677)