Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 1921364
End position: 1921408
Length: 45

DNA sequence
>NC_022657, from 1921364 to 1921408 (45 bp); Actinoplanes friuliensis DSM 7358 CCCGGTCCGAGACCGTCTGGCCCGAGACCGCCCGGTCCGCGATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1921081-1921587	Sequence	AFR_08870 - N-acetyltransferase GCN5 (Protein is coded in complementary strand; from 1921587 to 1921081)