Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 1857205
End position: 1857228
Length: 24

DNA sequence
>NC_022657, from 1857205 to 1857228 (24 bp); Actinoplanes friuliensis DSM 7358 CAGCAGCAGGAGCAGAAGCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1856705-1857289	Sequence	AFR_08545 - hypothetical protein (Protein is coded in complementary strand; from 1857289 to 1856705)