Sequence retrieval

Genome: Actinoplanes friuliensis DSM 7358
Start position: 1670562
End position: 1670585
Length: 24

DNA sequence
>NC_022657, from 1670562 to 1670585 (24 bp); Actinoplanes friuliensis DSM 7358 GCCGGTGCCGGTGCCGGTGCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1669749-1671230	Sequence	AFR_07640 - hypothetical protein (Protein is coded in complementary strand; from 1671230 to 1669749)